ID: 1163431218_1163431230

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1163431218 1163431230
Species Human (GRCh38) Human (GRCh38)
Location 19:17268892-17268914 19:17268935-17268957
Sequence CCAATCCTGAAGGGGCTGAGGAC CAGCGTGGGCAGCCGCAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120} {0: 1, 1: 1, 2: 1, 3: 20, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!