ID: 1163437747_1163437752

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1163437747 1163437752
Species Human (GRCh38) Human (GRCh38)
Location 19:17305465-17305487 19:17305481-17305503
Sequence CCAGCCAGCTGTGTGCCATCTGC CATCTGCCCAGCTCCCGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 315} {0: 1, 1: 0, 2: 2, 3: 52, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!