ID: 1163443563_1163443571

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1163443563 1163443571
Species Human (GRCh38) Human (GRCh38)
Location 19:17333878-17333900 19:17333900-17333922
Sequence CCCGCCAGGGCTCCTCACCACTC CCACCTGGCATTCAAGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 326} {0: 1, 1: 0, 2: 4, 3: 28, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!