ID: 1163449185_1163449193

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1163449185 1163449193
Species Human (GRCh38) Human (GRCh38)
Location 19:17365612-17365634 19:17365639-17365661
Sequence CCTCCACCTTGGAGCTCATGAGG GCATGTGGTCGCAGGCTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 153} {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!