ID: 1163460774_1163460784

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1163460774 1163460784
Species Human (GRCh38) Human (GRCh38)
Location 19:17436232-17436254 19:17436272-17436294
Sequence CCAGGAGACACCTAGCCAGCGCT CAGAATGAGGAGGTGAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 87} {0: 1, 1: 0, 2: 5, 3: 49, 4: 647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!