ID: 1163462694_1163462703

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1163462694 1163462703
Species Human (GRCh38) Human (GRCh38)
Location 19:17448459-17448481 19:17448496-17448518
Sequence CCATGGCGGGGGTTCCTGCGGGC AGGAATTGAAGTGGTTTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160} {0: 1, 1: 0, 2: 0, 3: 15, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!