ID: 1163471140_1163471148

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1163471140 1163471148
Species Human (GRCh38) Human (GRCh38)
Location 19:17497579-17497601 19:17497619-17497641
Sequence CCAAGGCGCACGCAGGGCGGGGT GACTCCCGGTGCACCACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104} {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!