ID: 1163488445_1163488457

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1163488445 1163488457
Species Human (GRCh38) Human (GRCh38)
Location 19:17603322-17603344 19:17603370-17603392
Sequence CCAGCCATCCAAAAATCTTCCAG CACTTCCCCTTTGGGCTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 349} {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!