ID: 1163507936_1163507949

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1163507936 1163507949
Species Human (GRCh38) Human (GRCh38)
Location 19:17719436-17719458 19:17719468-17719490
Sequence CCGGTGCGGCCCCTTTAAGAGGC GGGGCGGGCGCCGAGAACGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 4, 4: 46} {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!