ID: 1163508956_1163508963

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1163508956 1163508963
Species Human (GRCh38) Human (GRCh38)
Location 19:17724196-17724218 19:17724218-17724240
Sequence CCTGTATGATGAGGTAGGGAATG GGCTGACGTCCTGGAGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104} {0: 1, 1: 0, 2: 1, 3: 29, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!