ID: 1163516026_1163516036

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1163516026 1163516036
Species Human (GRCh38) Human (GRCh38)
Location 19:17764369-17764391 19:17764416-17764438
Sequence CCCCAGGGCCACCATCGAGGAGA TCTCCAAGCTGGCCAGCAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113} {0: 1, 1: 0, 2: 1, 3: 19, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!