ID: 1163520270_1163520280

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1163520270 1163520280
Species Human (GRCh38) Human (GRCh38)
Location 19:17787905-17787927 19:17787932-17787954
Sequence CCCGGGGTGTGGGGAGGGATTGG TGGGGATCCTTGGGAAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 565} {0: 1, 1: 1, 2: 0, 3: 21, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!