ID: 1163528579_1163528588

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1163528579 1163528588
Species Human (GRCh38) Human (GRCh38)
Location 19:17836169-17836191 19:17836213-17836235
Sequence CCCTGCTGCCTCTGTTCATACAG CCATCTCTGAATGATTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 16, 4: 260} {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!