ID: 1163529790_1163529802

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1163529790 1163529802
Species Human (GRCh38) Human (GRCh38)
Location 19:17842603-17842625 19:17842635-17842657
Sequence CCTTGTAGCTGCAGGGGTTGGAG CCGGCCCTCAGCGTCGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 324} {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!