ID: 1163551881_1163551890

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163551881 1163551890
Species Human (GRCh38) Human (GRCh38)
Location 19:17969895-17969917 19:17969912-17969934
Sequence CCAGCCCCACCTGGTAGCCAGCG CCAGCGGATGTTCAGGCAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!