ID: 1163554165_1163554174

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1163554165 1163554174
Species Human (GRCh38) Human (GRCh38)
Location 19:17983180-17983202 19:17983208-17983230
Sequence CCCGGAGCCTTGAGTCCTGGCAG GAGGCAGGAGGGGCTCCGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 116, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!