ID: 1163565546_1163565556

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1163565546 1163565556
Species Human (GRCh38) Human (GRCh38)
Location 19:18049042-18049064 19:18049087-18049109
Sequence CCGAGACCATTGGCCGCCATGGC CCAAGAAGAAATAAGTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 5, 4: 68} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!