ID: 1163586932_1163586949

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1163586932 1163586949
Species Human (GRCh38) Human (GRCh38)
Location 19:18169306-18169328 19:18169339-18169361
Sequence CCGCCCCAAGCAGAGCCGCCCCT GCGCCGGAGGCTGCGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 357} {0: 1, 1: 0, 2: 13, 3: 302, 4: 1087}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!