ID: 1163594049_1163594053

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1163594049 1163594053
Species Human (GRCh38) Human (GRCh38)
Location 19:18210707-18210729 19:18210736-18210758
Sequence CCTTAGAGAGCTCTTTTAGGCAA GGTCAGAGTGGACCCCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 254} {0: 1, 1: 2, 2: 2, 3: 38, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!