ID: 1163604546_1163604551

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1163604546 1163604551
Species Human (GRCh38) Human (GRCh38)
Location 19:18266840-18266862 19:18266861-18266883
Sequence CCCGGACTCTGGCAGCATGAGGA GACCCTGCACACAGGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 595} {0: 1, 1: 2, 2: 1, 3: 36, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!