ID: 1163635068_1163635089

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1163635068 1163635089
Species Human (GRCh38) Human (GRCh38)
Location 19:18433837-18433859 19:18433875-18433897
Sequence CCCCCCCCGCGGCGGCGTCGGGC GCAGGCCCCGGCGGGGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 262} {0: 2, 1: 0, 2: 6, 3: 53, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!