ID: 1163635570_1163635584

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1163635570 1163635584
Species Human (GRCh38) Human (GRCh38)
Location 19:18435728-18435750 19:18435773-18435795
Sequence CCCCGCGCCCGCGCCCGCGCCCC TCGCCGGGCGTATAGAGCACTGG
Strand - +
Off-target summary {0: 2, 1: 11, 2: 44, 3: 312, 4: 1750} {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!