ID: 1163635774_1163635775

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1163635774 1163635775
Species Human (GRCh38) Human (GRCh38)
Location 19:18436716-18436738 19:18436729-18436751
Sequence CCGCGCGCGCGCTCTGGTTGGCC CTGGTTGGCCGCGATGAATTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 47} {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!