ID: 1163641595_1163641603

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1163641595 1163641603
Species Human (GRCh38) Human (GRCh38)
Location 19:18465401-18465423 19:18465454-18465476
Sequence CCACTGCTCACCCAGGTAGCGGC TCCGCGTCTCCTCCTCCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150} {0: 1, 1: 0, 2: 2, 3: 15, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!