ID: 1163643084_1163643091

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1163643084 1163643091
Species Human (GRCh38) Human (GRCh38)
Location 19:18472943-18472965 19:18472957-18472979
Sequence CCCAAAGACTCCCTCCCCAGGTA CCCCAGGTATAGAAGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 205} {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!