ID: 1163643085_1163643091

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1163643085 1163643091
Species Human (GRCh38) Human (GRCh38)
Location 19:18472944-18472966 19:18472957-18472979
Sequence CCAAAGACTCCCTCCCCAGGTAT CCCCAGGTATAGAAGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 205} {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!