ID: 1163657821_1163657827

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163657821 1163657827
Species Human (GRCh38) Human (GRCh38)
Location 19:18557939-18557961 19:18557956-18557978
Sequence CCGAGTTTGGGGTGGGGCTGGGG CTGGGGACTCCAGGGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 91, 4: 699} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!