ID: 1163657829_1163657835

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1163657829 1163657835
Species Human (GRCh38) Human (GRCh38)
Location 19:18557965-18557987 19:18557978-18558000
Sequence CCAGGGCCGCGGGGAACCGGTCC GAACCGGTCCGGGTCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!