ID: 1163679060_1163679070

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1163679060 1163679070
Species Human (GRCh38) Human (GRCh38)
Location 19:18670129-18670151 19:18670156-18670178
Sequence CCTTTCCACCCCTCCGCGCCCTG TCCCTGGCCTGCCCTGTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 408} {0: 1, 1: 1, 2: 3, 3: 15, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!