ID: 1163698262_1163698274

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1163698262 1163698274
Species Human (GRCh38) Human (GRCh38)
Location 19:18774791-18774813 19:18774843-18774865
Sequence CCGTCTGGGAGGTTCCAGGGGCC CCGACTTCCCACCTGGCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 263} {0: 1, 1: 0, 2: 1, 3: 31, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!