ID: 1163702124_1163702130

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1163702124 1163702130
Species Human (GRCh38) Human (GRCh38)
Location 19:18791206-18791228 19:18791231-18791253
Sequence CCTGTCCGGACGCGCCGAGGGCA CAGGGTGAGCAGAAGAACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 29} {0: 1, 1: 0, 2: 1, 3: 22, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!