ID: 1163717060_1163717066

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1163717060 1163717066
Species Human (GRCh38) Human (GRCh38)
Location 19:18878862-18878884 19:18878885-18878907
Sequence CCCACGAACACGCTTGGACGGGT GACACTAAAGGAGGGAACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 7} {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!