ID: 1163730900_1163730910

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1163730900 1163730910
Species Human (GRCh38) Human (GRCh38)
Location 19:18948691-18948713 19:18948729-18948751
Sequence CCACGCTCCTTCTGTGGCCTTGG AACAGAGAGCAGAAGCCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!