ID: 1163750629_1163750635

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1163750629 1163750635
Species Human (GRCh38) Human (GRCh38)
Location 19:19075341-19075363 19:19075385-19075407
Sequence CCATACCCCGCCGAGCTTTGTTT CTGCATGAACAGAAGCAGCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!