ID: 1163755930_1163755939

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1163755930 1163755939
Species Human (GRCh38) Human (GRCh38)
Location 19:19106152-19106174 19:19106172-19106194
Sequence CCTCGGTCCCCACCCCTGTCCCC CCCGCCCCAGCAGAGACGTGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 142, 4: 2359} {0: 1, 1: 0, 2: 1, 3: 17, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!