ID: 1163755932_1163755946

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163755932 1163755946
Species Human (GRCh38) Human (GRCh38)
Location 19:19106160-19106182 19:19106186-19106208
Sequence CCCACCCCTGTCCCCGCCCCAGC GACGTGCGGGTGCTCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 235, 4: 2011} {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!