ID: 1163755934_1163755947

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1163755934 1163755947
Species Human (GRCh38) Human (GRCh38)
Location 19:19106164-19106186 19:19106187-19106209
Sequence CCCCTGTCCCCGCCCCAGCAGAG ACGTGCGGGTGCTCCAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 593} {0: 1, 1: 0, 2: 1, 3: 7, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!