ID: 1163768676_1163768687

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1163768676 1163768687
Species Human (GRCh38) Human (GRCh38)
Location 19:19177842-19177864 19:19177880-19177902
Sequence CCAAGCCGGGCTCTGCTCTTCTC TTTTTTTGGTTGGGGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 273} {0: 1, 1: 7, 2: 78, 3: 494, 4: 2555}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!