ID: 1163782385_1163782394

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1163782385 1163782394
Species Human (GRCh38) Human (GRCh38)
Location 19:19257351-19257373 19:19257394-19257416
Sequence CCCAGTGTCCCACGTGACCGCAA AGTGAGATGCAGAAGGTGTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34} {0: 1, 1: 0, 2: 4, 3: 26, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!