ID: 1163804130_1163804140

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1163804130 1163804140
Species Human (GRCh38) Human (GRCh38)
Location 19:19385939-19385961 19:19385961-19385983
Sequence CCCCGCCGCCCGAGCGCGCCCCG GCGCCGCCCGCGCAGTCGGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 51, 4: 397} {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!