ID: 1163804145_1163804161

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1163804145 1163804161
Species Human (GRCh38) Human (GRCh38)
Location 19:19385996-19386018 19:19386042-19386064
Sequence CCTGTCGCCGCTGCCGCCGCCGC CCTGAGGGAGTCGCCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 256, 3: 546, 4: 1301} {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!