ID: 1163804146_1163804161

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1163804146 1163804161
Species Human (GRCh38) Human (GRCh38)
Location 19:19386003-19386025 19:19386042-19386064
Sequence CCGCTGCCGCCGCCGCCACAGCG CCTGAGGGAGTCGCCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 37, 3: 540, 4: 2881} {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!