ID: 1163804873_1163804883

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1163804873 1163804883
Species Human (GRCh38) Human (GRCh38)
Location 19:19389644-19389666 19:19389669-19389691
Sequence CCTGGTCAGCTGTAGGCACTGCC CAGGGGAAGGGAAAGTTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 137} {0: 1, 1: 1, 2: 5, 3: 82, 4: 858}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!