ID: 1163817565_1163817570

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1163817565 1163817570
Species Human (GRCh38) Human (GRCh38)
Location 19:19476058-19476080 19:19476083-19476105
Sequence CCTCCTCTGGTCATGGAGGGGAC GGATCCCTAACTTTGAAATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!