ID: 1163830713_1163830723

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1163830713 1163830723
Species Human (GRCh38) Human (GRCh38)
Location 19:19545981-19546003 19:19545999-19546021
Sequence CCCCTCCGCACCCGCCGGGGTAG GGTAGGGTCCGGCAGTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!