ID: 1163845850_1163845857

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1163845850 1163845857
Species Human (GRCh38) Human (GRCh38)
Location 19:19637743-19637765 19:19637767-19637789
Sequence CCAGGGGACAGGACCTCATGGGG GGAGCCGAGACAGTGGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 263} {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!