ID: 1163845850_1163845861

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1163845850 1163845861
Species Human (GRCh38) Human (GRCh38)
Location 19:19637743-19637765 19:19637772-19637794
Sequence CCAGGGGACAGGACCTCATGGGG CGAGACAGTGGGTCTGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 263} {0: 1, 1: 0, 2: 2, 3: 33, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!