ID: 1163850991_1163850996

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163850991 1163850996
Species Human (GRCh38) Human (GRCh38)
Location 19:19663551-19663573 19:19663568-19663590
Sequence CCGGCGGCAAGGAGCGCGCGCGG GCGCGGCTGCGGCCCGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91} {0: 1, 1: 0, 2: 2, 3: 48, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!