ID: 1163851932_1163851944

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1163851932 1163851944
Species Human (GRCh38) Human (GRCh38)
Location 19:19669128-19669150 19:19669157-19669179
Sequence CCAGCCGCCGGGACCCCGGGTGT CCGGCCCCGGAGCCCTCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 19, 4: 123} {0: 1, 1: 1, 2: 6, 3: 24, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!