ID: 1163882249_1163882254

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1163882249 1163882254
Species Human (GRCh38) Human (GRCh38)
Location 19:19935347-19935369 19:19935368-19935390
Sequence CCCTCATCACTACAAATTCAGAG AGGGCATCTCATCACCCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 3, 3: 18, 4: 221} {0: 6, 1: 3, 2: 4, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!